🧫
experiment

Ingenuity Pathway Analysis of miR-130a target interactions

🧫 Experiment Protocol Exploratorytype 2 diabetes mellitus, obesity, ischemic diseasemiR-130a target genescomputational analysis using Ingenuity Pathway Analysisproposed
This bioinformatics experiment used Ingenuity Pathway Analysis (IPA) to identify and analyze potential gene targets and interaction networks for miR-130a. The analysis aimed to understand the molecular mechanisms by which miR-130a might influence angiogenic processes in extracellular vesicles. IPA identified a number of genes as among the most significant miR-130a interactors, providing insights into the regulatory networks that may be involved in the differential angiogenic properties observed in sEV from different patient populations. This computational analysis helped to identify potential therapeutic targets and mechanistic pathways.
PRIMARY OUTCOME
identification of miR-130a target genes and interaction networks
EXPECTED OUTCOMES
## Primary Outcomes **Target Discovery**: Identify 20-40 high-confidence miR-130a targets meeting: present in ≥2 prediction algorithms, involved in ≥2 canonical pathways, and conserved in ≥1 model organism. Top candidates include ADRB1, PPARA, VECAD/CDH5, and PPARGC1A. **Pathway Enrichment**: B-H FDR < 0.05 enrichment in PI3K/AKT signaling (n~15 genes), MAPK cascade (n~10 genes), and TGF-β pathway (n~8 genes). Causal network analysis identifies 3-5 activated kinases and 2-3 repressed transcription factors. ## Secondary Outcomes **Cross-Species Conservation**: 45-55% of cardiovascular-relevant miR-130a targets conserved in mouse with ≥80% seed region identity, enabling in vivo validation in atherosclerosis models. **Literature Curation**: Among top 20 candidates, ≥12 have ≥1 published direct validation study confirming miR-130a targeting, providing confidence in computational predictions.
SUCCESS CRITERIA
## Primary Success Criteria **Network Quality**: Core network must achieve IPA quality score ≥0.6 (composite of confidence, literature support, and connectivity). Canonical pathway enrichment: ≥5 significantly enriched pathways at B-H FDR < 0.05. **Target Confidence**: Top 10 predicted targets must have either: (a) ≥1 published direct validation study, or (b) ≥2 independent prediction algorithms plus strong pathway membership (≥3 disease-relevant pathways). ## Secondary Success Criteria **Conservation Validity**: For in vivo validation candidates, ≥80% must show conserved miR-130a targeting in mouse/rat orthologs with seed region identity ≥80%. **Functional Concordance**: miR-130a expression changes must produce mechanistically consistent effects for ≥75% of top 20 targets (direction agreement across IPA causal analysis), confirming biological plausibility.
PROTOCOL
# Ingenuity Pathway Analysis of miR-130a Target Interactions Protocol ## Phase 1: miR-130a Target Prediction and Database Preparation (Days 1-7) **miR-130a Sequence Retrieval**: Obtain mature hsa-miR-130a-3p sequence (GUUCAGUGCUGAUGUGGCAGC) from miRBase (v22). Extract seed region (nucleotides 2-8: UUUAGU). Download all human 3'/5' UTR sequences from RefSeq (GRCh38.p13, n=19,650 protein-coding genes). **In Silico Target Prediction**: Run multiple algorithms for target prediction: (a) TargetScan (v8.0, context+ score threshold ≤-0.1), (b) miRanda (v3.3a, score ≥150), (c) RNAhybrid (minimum free energy <-20 kcal/mol). Compile consensus set (present in ≥2 algorithms). **Network Construction**: Build interaction network in IPA with: (a) direct miR-130a-target relationships (validated + high-confidence predicted), (b) upstream regulators, (c) downstream canonical pathways. Set species filter to human/mouse/rat. ## Phase 2: Canonical Pathway and Functional Enrichment (Days 8-14) **Pathway Enrichment Analysis**: Run IPA Canonical Pathways with Fisher's exact test (right-tailed) and B-H FDR correction (< 0.05). Prioritize pathways in disease-relevant categories: cardiovascular disease, metabolic disease, PI3K/AKT signaling, TGF-β, and MAPK cascades. **Upstream Regulator Analysis**: Identify upstream transcription factors and kinases predicted to be activated/inhibited based on downstream gene expression changes. Calculate activation Z-scores; report regulators with |Z| > 2.0. **Disease and Bio Function Annotation**: Map predicted targets to IPA Diseases & Bio Functions categories. Focus on: (a) cardiovascular system development and function, (b) lipid metabolism, (c) inflammatory response, (d) glucose homeostasis. ## Phase 3: Experimental Validation Prioritization (Days 15-21) **Top Candidate Selection**: Rank predicted targets by composite score: (a) prediction algorithm confidence (0-1), (b) number of disease-relevant pathway memberships (0-10), (c) cross-species conservation (0-1), (d) literature support (0-1). Select top 20 candidates for experimental planning. **Conserved vs. Species-Specific Targeting**: For mouse/rat models, assess target ortholog conservation (≥80% seed region identity required). Identify any targets conserved only in human, which would limit translational relevance. **Validation Strategy Design**: For each top 20 target, propose experimental approach: (a) luciferase 3' UTR reporter assay, (b) miR-130a inhibitor/activator treatment + qRT-PCR, or (c) CLIP-seq from existing datasets. Prioritize targets amenable to in vivo validation.
Source: PMID 31959759 ↗
🧫 Experiment Extras
PATHWAY
miR-130a regulatory networks, angiogenesis pathway
MARKET PRICE
$0.50
STATUS
proposed
View on SciDEX ↗