🧫 Experiment Protocol
ExploratoryMycoplasma pneumoniae pneumoniaCD86, CXCL10, CD206, ARG1, MRC1Primary mouse lung and bone marrow macrophagesproposed
Primary mouse lung and bone marrow cells were isolated to examine the effects of QTJD-containing serum on macrophage polarization in response to Mycoplasma pneumoniae infection. The study investigated how QTJD modulates macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype through butyric acid. Cell viability assays, flow cytometry, and quantitative reverse transcription-PCR were performed to assess macrophage phenotype markers. The experiment demonstrated that QTJD reduced M1 markers (CD86, CXCL10) and enhanced M2 markers (CD206, Arg-1, MRC-1), promoting beneficial M2 polarization and alleviating inflammatory responses.
PRIMARY OUTCOME
Macrophage polarization markers (M1 vs M2 phenotype)
EXPECTED OUTCOMES
1. **CD86 mRNA expression**: QTJD treatment will increase CD86 transcript levels by 2.8 ± 0.4-fold at 5 μM compared to vehicle control (p < 0.01, n = 6 biological replicates), as measured by RT-qPCR after 24 h treatment.
2. **CXCL10 secretion**: M. pneumoniae antigen stimulation in presence of QTJD (5 μM) will elevate CXCL10 protein in supernatant to 847 ± 95 pg/mL versus 312 ± 48 pg/mL in antigen-only control (p < 0.001, n = 5).
3. **CD206 (MRC1) mRNA expression**: QTJD treatment will decrease CD206 transcript by 0.35 ± 0.08-fold relative to vehicle (p < 0.01) at 5 μM concentration after 48 h, indicating M1 skewing.
4. **ARG1 activity**: Intracellular ARG1 protein expression will be reduced to 28 ± 6% of IL-4/IL-13-induced M2 control levels following QTJD (5 μM) treatment, as quantified by flow cytometry MFI (p < 0.001, n = 6).
5. **Flow cytometry MFI for CD86**: CD86 surface expression will increase from baseline MFI of 1,247 ± 186 to 3,892 ± 412 with QTJD (5 μM) + M. pneumoniae antigen co-treatment (p < 0.0001, n = 5).
6. **Nitric oxide production**: NO secretion will increase to 18.3 ± 2.7 μM in QTJD (5 μM) + LPS/IFN-γ treated BMDMs compared to 3.1 ± 0.9 μM in QTJD alone (p < 0.001), confirming enhanced M1 activation.
7. **Phagocytosis capacity**: M2-polarized macrophages (IL-4/IL-13) show 3.4 ± 0.5-fold higher phagocytosis of E. coli bioparticles compared to QTJD-treated cells (5 μM), which maintain low phagocytic activity similar to M1 phenotype.
---
SUCCESS CRITERIA
- **RT-qPCR validation**: CD86 upregulation ≥2.5-fold and CD206/MRC1 downregulation ≤0.4-fold in QTJD-treated (5 μM) versus vehicle (DMSO) at 24 h, with p < 0.01 by unpaired two-tailed t-test, effect size (Cohen's d) > 1.2
- **Flow cytometry confirmation**: ≥75% of CD11b+ F4/80+ cells co-express CD86 at high levels (MFI > 3000) after QTJD treatment, with <15% showing CD206 high phenotype, verified in ≥3 independent experiments
- **Cytokine release**: CXCL10 levels in QTJD + M. pneumoniae antigen co-culture supernatant exceed 700 pg/mL, significantly higher than antigen-only control (p < 0.001, one-way ANOVA with Tukey's post-hoc)
- **Dose-response relationship**: EC50 for QTJD-mediated CD86 upregulation calculated from 3-point dose-response curve (1, 5, 10 μM) falls within 3-7 μM range, with R² > 0.85 for sigmoidal fit
- **Cell viability**: LDH release assay shows <10% cytotoxicity at all QTJD concentrations used (1-10 μM) after 72 h treatment, confirming lack of compound toxicity
- **Positive control validation**: M1 markers (CD86, CXCL10, NO) significantly elevated in LPS/IFN-γ positive control versus vehicle (p < 0.001); M2 markers (CD206, ARG1) significantly elevated in IL-4/IL-13 positive control versus vehicle (p < 0.001)
- **Reproducibility**: All key findings (CD86 upregulation, CD206 downregulation, CXCL10 induction) replicated in both BMDMs and lung-associated macrophages from ≥2 independent mouse cohorts (n ≥ 4 mice per cohort per cell type)
PROTOCOL
### PHASE 1: Macrophage Isolation and Culture (Day 0-2)
**1.1 Bone Marrow-Derived Macrophages (BMDMs)**
- Euthanize 8-12 week old C57BL/6 mice via CO2 inhalation followed by cervical dislocation
- Harvest femurs and tibias aseptically
- Flush bone marrow with RPMI-1640 medium containing 10% FBS, 1% penicillin-streptomycin
- Filter through 70 μm cell strainer, centrifuge at 300×g for 5 min
- Resuspend in complete RPMI-1640 supplemented with 10 ng/mL M-CSF (PeproTech, #300-25)
- Culture in 10 cm bacterial petri dishes for 7 days at 37°C, 5% CO2
- Replace media on Day 3 and Day 5
- Harvest differentiated macrophages (CD11b+ F4/80+) on Day 7
**1.2 Lung-Associated Macrophages (LAMs)**
- Perfuse mouse lungs with PBS via cardiac puncture
- Digest lung tissue with collagenase D (2 mg/mL, Roche, #11088882001) and DNase I (50 μg/mL, Sigma, #DN25) in HBSS at 37°C for 45 min
- Disrupt tissue through 70 μm strainer
- Enrich macrophages using CD11b MicroBeads (Miltenyi, #130-049-601) per manufacturer protocol
- Culture in RPMI-1640 with 10% FBS, 20 ng/mL M-CSF for 48 h prior to treatment
### PHASE 2: QTJD Preparation and Treatment (Day 7-9)
**2.1 QTJD Solution Preparation**
- Dissolve QTJD (provided as lyophilized powder, stored at -80°C) in DMSO to create 10 mM stock
- Further dilute in complete RPMI-1640 to working concentrations: 1 μM, 5 μM, 10 μM
- Final DMSO concentration ≤0.1% in all treatments
**2.2 Macrophage Treatment**
- Seed BMDMs and LAMs in 12-well plates at 5×10^5 cells/well
- Allow to adhere overnight
- Treat cells with:
- **Vehicle control**: 0.1% DMSO in complete media
- **QTJD low**: 1 μM QTJD
- **QTJD medium**: 5 μM QTJD
- **QTJD high**: 10 μM QTJD
- **Positive control (M1)**: 100 ng/mL LPS (Sigma, #L2630) + 20 ng/mL IFN-γ (PeproTech, #315-05)
- **Positive control (M2)**: 20 ng/mL IL-4 (PeproTech, #214-14) + 20 ng/mL IL-13 (PeproTech, #210-13)
- Incubate for 24 h (M1 polarization) or 48 h (M2 polarization) at 37°C, 5% CO2
### PHASE 3: M1/M2 Polarization Induction with Mycoplasma Antigen (Day 8-10)
**3.1 Mycoplasma pneumoniae Antigen Preparation**
- Use commercially available M. pneumoniae membrane protein antigen (Austral Biologicals, #P-100-10)
- Reconstitute in PBS at 1 mg/mL, sonicate briefly to disaggregate
**3.2 Co-treatment Protocol**
- On Day 8, replace culture medium with fresh complete RPMI-1640
- Co-treat macrophages with QTJD (5 μM, EC50 concentration) + M. pneumoniae antigen (10 μg/mL)
- Include appropriate single-treatment controls
- Incubate for additional 24 h
- Collect supernatant for cytokine analysis, freeze at -80°C
- Harvest cells for RNA/protein analysis
### PHASE 4: Gene Expression Analysis (Day 9-11)
**4.1 RNA Extraction**
- Extract total RNA using RNeasy Mini Kit (Qiagen, #74104) per manufacturer protocol
- Quantify using NanoDrop 2000 (Thermo Fisher)
- Ensure A260/A280 ratio >1.9, A260/A230 >2.0
- Store RNA at -80°C
**4.2 RT-qPCR**
- Synthesize cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368814)
- Perform qPCR using Power SYBR Green PCR Master Mix (Applied Biosystems, #4367659)
- Primer sequences (5'→3'):
- CD86: F: GGCTACCACTGAAAAACCCC, R: CAGACGGTGTCTTAGCTCGG
- CXCL10: F: ATGACGGGCCAGTGAGAAT, R: TCTTCCCTATGGCCCTCATT
- CD206 (MRC1): F: GCATCTGGCTCTGGCTCTTT, R: CCTGATCCCAGTGTTCCAGA
- ARG1: F: CTCCAAGCCAAAGTCCTTAGAG, R: AGGAGCTGTCATTAGGGACATC
- GAPDH: F: AACTTTGGCATTGTGGAAGG, R: ACACATTGGGGGTAGGAACA
- Run on Applied Biosystems 7500 Fast Real-Time PCR System
- Analyze using 2^-ΔΔCt method, normalize to GAPDH
### PHASE 5: Protein Expression and Flow Cytometry (Day 10-11)
**5.1 Surface Marker Staining**
- Harvest cells using accutase (Sigma, #A6964), wash in PBS
- Block Fc receptors with CD16/32 antibody (BD, #553142) for 10 min at 4°C
- Stain with fluorochrome-conjugated antibodies:
- CD86-PE (BD, #553691, 1:100)
- CD206-FITC (BioLegend, #141004, 1:100)
- F4/80-APC (BioLegend, #123116, 1:100)
- CD11b-PerCP-Cy5.5 (BD, #550993, 1:100)
- Incubate 30 min at 4°C in the dark
- Wash twice with FACS buffer (PBS + 2% FBS)
- Resuspend in 300 μL FACS buffer + 1% paraformaldehyde
**5.2 Intracellular Staining (ARG1)**
- Fix cells with 4% paraformaldehyde for 15 min at RT
- Permeabilize with 0.1% Triton X-100 for 10 min
- Block with 5% normal goat serum
- Stain with ARG1-Alexa Fluor 647 (R&D Systems, #IC5868A, 1:50) or appropriate primary + secondary
- Analyze within 24 h
**5.3 Flow Cytometry Acquisition**
- Acquire on BD LSRFortessa X-20 with FACSDiva software
- Gate on live cells (forward/side scatter), then CD11b+ F4/80+ population
- Analyze 10,000 events per sample
- Data analysis using FlowJo v10.8.1
### PHASE 6: Cytokine and Functional Assays (Day 10-12)
**6.1 Cytokine Profiling**
- Analyze culture supernatant using LEGENDplex Mouse Macrophage/Microglia Panel (BioLegend, #740846)
- Measure: TNF-α, IL-6, IL-10, IL-12p70, CXCL10, CCL17, CCL22
- Run on BD LSRFortessa, analyze with LEGENDplex software
**6.2 Phagocytosis Assay**
- Label heat-killed E. coli bioparticles with Alexa Fluor 594 (Thermo Fisher, #E35372)
- Incubate macrophages with opsonized bioparticles (10:1 ratio) for 1 h at 37°C
- Quench with trypan blue, wash, analyze by flow cytometry
- Report as mean fluorescence intensity (MFI)
**6.3 Nitric Oxide (NO) Production**
- Measure nitrite accumulation using Griess Reagent System (Promega, #G2930)
- Mix 50 μL supernatant with equal volume sulfanilamide solution and NED solution
- Read at 540 nm on Synergy H1 microplate reader
- Quantify against sodium nitrite standard curve
---