🧫
experiment

ABT263 treatment in sublethally irradiated mice

🧫 Experiment Protocol Validationradiation-induced premature agingsublethally irradiated miceproposed
Mice were subjected to sublethal total-body irradiation (TBI) to induce premature aging and accumulation of senescent cells. Following irradiation, mice were treated orally with ABT263 to test its ability to deplete senescent cells in vivo and mitigate radiation-induced premature aging. The study evaluated the effects on hematopoietic stem cells (HSCs) and muscle stem cells (MuSCs), measuring senescent cell clearance and functional rejuvenation of the hematopoietic system.
PRIMARY OUTCOME
depletion of senescent cells and mitigation of TBI-induced premature aging
EXPECTED OUTCOMES
1. **Survival**: 100% survival in sham groups; ≥85% survival in TBI groups (ABT263 may slightly reduce survival due to on-target senolytic activity in platelets) 2. **SA-βgal+ Cell Burden (Week 16)**: - TBI-vehicle: 18.4 ± 4.2% SA-βgal+ cells in liver - TBI-ABT263: 8.1 ± 2.1% SA-βgal+ cells (55% reduction, p < 0.001) 3. **p16INK4a mRNA Expression (Week 16, liver)**: - TBI-vehicle: 4.7 ± 0.9 fold increase vs sham-vehicle - TBI-ABT263: 2.1 ± 0.6 fold increase vs sham-vehicle (p < 0.01) 4. **Rotarod Performance (Week 16)**: - Sham-vehicle: 245 ± 28 seconds - TBI-vehicle: 167 ± 31 seconds (31% impairment, p < 0.001) - TBI-ABT263: 218 ± 24 seconds (73% improvement vs TBI-vehicle, p < 0.01) 5. **Serum IL-6 (Week 16)**: - Sham-vehicle: 12.4 ± 3.1 pg/mL - TBI-vehicle: 47.8 ± 9.2 pg/mL (3.9-fold elevation, p < 0.001) - TBI-ABT263: 24.6 ± 6.8 pg/mL (48% reduction vs TBI-vehicle, p < 0.01) 6. **Grip Strength (Week 16)**: - TBI-vehicle: 62% of sham-vehicle baseline - TBI-ABT263: 81% of sham-vehicle baseline (p < 0.05) 7. **Telomere Length (Week 16, liver)**: - TBI-vehicle: T/S ratio 0.68 ± 0.07 (vs 1.0 for sham) - TBI-ABT263: T/S ratio 0.81 ± 0.06 (p < 0.05) ---
SUCCESS CRITERIA
- **SA-βgal reduction**: ABT263 treatment reduces SA-βgal+ cell burden by ≥40% in liver, kidney, and lung combined compared to TBI-vehicle (two-tailed Mann-Whitney U test, p < 0.05) - **Functional improvement**: Statistically significant improvement in rotarod latency in TBI-ABT263 vs TBI-vehicle groups (two-way ANOVA with Bonferroni post-hoc, p < 0.01) - **Inflammaging suppression**: Serum IL-6 levels in TBI-ABT263 group ≤50% of TBI-vehicle levels (Welch's t-test, p < 0.01, effect size Cohen's d ≥ 0.8) - **p16INK4a knockdown**: ≥40% reduction in p16INK4a mRNA in liver tissue of TBI-ABT263 vs TBI-vehicle (ΔΔCt analysis, p < 0.01) - **No toxicity threshold**: No more than 15% body weight loss in any ABT263-treated group compared to vehicle controls at any timepoint (one-way ANOVA, p > 0.05) - **Histopathological improvement**: Semiquantitative pathology scores for liver and kidney show ≥1-point improvement on 0–4 scale in TBI-ABT263 vs TBI-vehicle (Kruskal-Wallis, p < 0.05) - **Telomere preservation**: T/S ratio in TBI-ABT263 significantly higher than TBI-vehicle (Welch's t-test, p < 0.05, effect size Cohen's d ≥ 0.6)
PROTOCOL
### Study Design Overview - **Model**: C57BL/6J female mice (12-week-old) - **Groups**: 4 groups (n=15/group) 1. Sham irradiation + Vehicle 2. Sham irradiation + ABT263 3. Sublethal TBI (7 Gy, single dose) + Vehicle 4. Sublethal TBI + ABT263 - **ABT263 Dose**: 50 mg/kg/day, oral gavage, 5 days on/2 days off for 8 weeks - **Total Duration**: 16 weeks post-irradiation --- ### PHASE 1: Baseline & Irradiation (Day 0) **Timepoints**: Day 0 **Methods**: 1. Randomize 60 mice into 4 groups using stratified randomization by body weight 2. For TBI groups: Whole-body irradiation using Cs-137 γ-ray source (Shepard C-120, 0.98 Gy/min, dose rate calibrated with ion chamber) 3. Total dose: 7 Gy (sublethal, ~80% survival) 4. Sham groups: Same handling without irradiation 5. Record baseline body weight, food consumption, and motor function (rotarod test) **Reagents/Equipment**: - ABT263 (Selleckchem, S1001) - dissolved in 10% DMSO + 30% PEG400 + 60% saline - Vehicle: 10% DMSO + 30% PEG400 + 60% saline - Cs-137 irradiator (Shepard C-120) --- ### PHASE 2: Treatment Period (Week 1–8) **Timepoints**: Daily (5 days/week) **Methods**: 1. ABT263 or vehicle administered via oral gavage (10 μL/g body weight) 2. Monitor daily for: - Body weight (twice weekly) - Food/water consumption (weekly) - General health score (ruffled fur, mobility, posture) 3. Rotate injection sites to prevent tissue irritation **Reagents/Equipment**: - Oral gavage needles (22 gauge, 1.5 inch) - Precision balance (Mettler Toledo) --- ### PHASE 3: Phenotypic Assessment - Physical Function (Week 4, 8, 12, 16) **Timepoints**: Week 4, 8, 12, 16 **Methods**: **Rotarod Test**: - Apparatus: Rotarod (IITC Life Science) - Protocol: Accelerating rotation 4–40 rpm over 300 seconds - Record latency to fall (maximum 300 sec) - 3 trials per session, 15 min rest between trials **Grip Strength Test**: - Meter: Chatillon DFE II digital force gauge - Measure forelimb grip force (grams force) - 5 consecutive measurements per session **Treadmill Endurance Test**: - Equipment: Columbus Instruments Exer3/6 - Protocol: 10 m/min for 2 min, then 2 m/min increments every 2 min up to 26 m/min - Record exhaustion time and distance --- ### PHASE 4: Senescence Biomarker Assessment (Week 8 and Week 16) **Timepoints**: Week 8 (n=5/group terminal), Week 16 (n=10/group terminal) **Methods**: **Tissue Collection**: 1. Euthanize by CO₂ inhalation (approved protocol) 2. Collect: liver, kidney, lung, quadriceps muscle, brain (cortex), heart, and bone marrow 3. Tissues flash-frozen in liquid N₂ or fixed in 4% paraformaldehyde **SA-βgal Staining (Cryosections)**: - 10 μm cryosections - Stain with X-gal solution: 1 mg/mL X-gal, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl₂ in PBS (pH 6.0) - Incubate 16 hours at 37°C (no CO₂) - Counterstain with eosin - Count SA-βgal+ cells per 1000 cells in 10 random fields (200x magnification) **Quantitative PCR (qPCR) for Senescence Markers**: - RNA extraction: RNeasy Mini Kit (Qiagen, 74104) - Reverse transcription: SuperScript III (ThermoFisher) - qPCR primers (Applied Biosystems): - p16INK4a: Mm00494448_m1 - p21CIP1: Mm04240740_g1 - IL-6: Mm00446190_m1 - MMP-3: Mm00440295_m1 - GAPDH (endogenous control) - Normalize using ΔΔCt method **Western Blot**: - 30 μg protein per lane - Primary antibodies: anti-p16 (Abcam ab189034, 1:500), anti-p21 (Abcam ab188224, 1:500), anti-Bcl-xL (Cell Signaling #2764, 1:1000), anti-β-actin (Sigma A2228, 1:5000) - Secondary: HRP-conjugated anti-rabbit (Cell Signaling #7074, 1:5000) - Detection: ECL substrate (ThermoFisher) --- ### PHASE 5: Inflammaging & Cytokine Profiling (Week 8, Week 16) **Timepoints**: Week 8, Week 16 **Methods**: - Serum collected via cardiac puncture - Multiplex cytokine assay (MILLIPLEX MAP Mouse Cytokine/Chemokine Panel, MCYTOMAG-70K): - IL-1β, IL-6, TNF-α, IFN-γ, CXCL1, CCL2 - Analysis using Luminex MAGPIX system --- ### PHASE 6: Comprehensive Tissue Analysis (Week 16, Terminal) **Timepoints**: Week 16 (final endpoint) **Methods**: **Histopathology**: - H&E staining of liver, kidney, lung, quadriceps - Scoring for: - Hepatocyte nuclear atypia (0–4 scale) - Renal tubular degeneration (0–4 scale) - Alveolar septal thickening (0–4 scale) - Muscle fiber cross-sectional area (μm²) **Telomere Length Analysis (qPCR)**: - Extract genomic DNA from liver and blood - Telomere primer sequences: - Telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT - Telc: GGTTGCGGGGGCTGGGTT - Reference single-copy gene: 36B4 - Telomere/Single-Copy Gene ratio (T/S ratio) **DNA Damage Markers (γH2AX foci)**: - Immunofluorescence on tissue sections - Primary: anti-γH2AX (phospho-S139, Abcam ab2893, 1:200) - Secondary: Alexa Fluor 488 anti-mouse (1:500) - Count foci per nucleus (n=100 nuclei per sample) **Bone Marrow Senescence Burden**: - Flow cytometry of bone marrow cells - Staining: anti-CD45-BV605, anti-CD11b-PE, anti-p16INK4a-FITC (flow cytometry) - Analyze on BD LSRFortessa ---
Source: PMID 26657143 ↗
🧫 Experiment Extras
PATHWAY
BCL-2/BCL-xL apoptosis pathway, hematopoietic stem cell maintenance
MARKET PRICE
$0.50
STATUS
proposed
View on SciDEX ↗