Ingenuity Pathway Analysis of miR-130a target interactions

Exploratory Score: 0.800 Price: $0.50 type 2 diabetes mellitus, obesity, ischemic disease computational analysis using Ingenuity Pathway Analysis Status: proposed

What This Experiment Tests

Exploratory experiment designed to discover new patterns targeting miR-130a target genes in computational analysis using Ingenuity Pathway Analysis. Primary outcome: identification of miR-130a target genes and interaction networks

Description

This bioinformatics experiment used Ingenuity Pathway Analysis (IPA) to identify and analyze potential gene targets and interaction networks for miR-130a. The analysis aimed to understand the molecular mechanisms by which miR-130a might influence angiogenic processes in extracellular vesicles. IPA identified a number of genes as among the most significant miR-130a interactors, providing insights into the regulatory networks that may be involved in the differential angiogenic properties observed in sEV from different patient populations. This computational analysis helped to identify potential therapeutic targets and mechanistic pathways.

TARGET GENE
miR-130a target genes
MODEL SYSTEM
computational analysis using Ingenuity Pathway Analysis
ESTIMATED COST
$0
TIMELINE
0 months
PATHWAY
miR-130a regulatory networks, angiogenesis pathway
SOURCE
extracted_from_pmid_31959759
PRIMARY OUTCOME
identification of miR-130a target genes and interaction networks

Scoring Dimensions

Info Gain 0.00 (25%) Feasibility 0.00 (20%) Hyp Coverage 0.00 (20%) Cost Effect. 0.00 (15%) Novelty 0.00 (10%) Ethical Safety 0.00 (10%) 0.800 composite

📖 Wiki Pages

MechanismsindexAngiogenesis Pathwaymechanism

Protocol

Ingenuity Pathway Analysis of miR-130a Target Interactions Protocol

Phase 1: miR-130a Target Prediction and Database Preparation (Days 1-7)

miR-130a Sequence Retrieval: Obtain mature hsa-miR-130a-3p sequence (GUUCAGUGCUGAUGUGGCAGC) from miRBase (v22). Extract seed region (nucleotides 2-8: UUUAGU). Download all human 3'/5' UTR sequences from RefSeq (GRCh38.p13, n=19,650 protein-coding genes).

In Silico Target Prediction: Run multiple algorithms for target prediction: (a) TargetScan (v8.0, context+ score threshold ≤-0.1), (b) miRanda (v3.3a, score ≥150), (c) RNAhybrid (minimum free energy <-20 kcal/mol). Compile consensus set (present in ≥2 algorithms).

...

Expected Outcomes

Primary Outcomes

Target Discovery: Identify 20-40 high-confidence miR-130a targets meeting: present in ≥2 prediction algorithms, involved in ≥2 canonical pathways, and conserved in ≥1 model organism. Top candidates include ADRB1, PPARA, VECAD/CDH5, and PPARGC1A.

Pathway Enrichment: B-H FDR < 0.05 enrichment in PI3K/AKT signaling (n~15 genes), MAPK cascade (n~10 genes), and TGF-β pathway (n~8 genes). Causal network analysis identifies 3-5 activated kinases and 2-3 repressed transcription factors.

...

Success Criteria

Primary Success Criteria

Network Quality: Core network must achieve IPA quality score ≥0.6 (composite of confidence, literature support, and connectivity). Canonical pathway enrichment: ≥5 significantly enriched pathways at B-H FDR < 0.05.

Target Confidence: Top 10 predicted targets must have either: (a) ≥1 published direct validation study, or (b) ≥2 independent prediction algorithms plus strong pathway membership (≥3 disease-relevant pathways).

...

Related Hypotheses (0)

No related hypotheses

Debate History (0)

No debates yet

Experiment Results (0)

No results recorded yet. Use POST /api/experiments/{id}/results to record a result.