IDH1 and IDH2 mutation sequencing in CNS and non-CNS tumors

PRIMARY OUTCOME

frequency and distribution of IDH1 and IDH2 mutations

EXPECTED OUTCOMES

1. **CNS tumor cohort**: IDH1/IDH2 mutation frequency of 75-85% in astrocytomas (WHO II-IV) and oligodendrogliomas, with R132H accounting for >80% of IDH1 mutations, consistent with TCGA and CBTTC datasets. 2. **Non-CNS tumor cohort**: IDH1/IDH2 mutation frequency of 2-5% across colorectal carcinoma (primarily R132C), 10-15% in cholangiocarcinoma (R132C/G), and 10-15% in AML (R172K), as reported in COSMIC and cBioPortal databases. 3. **Glioblastoma stratification**: Primary glioblastomas (de novo) will show 5-10% IDH mutation rate versus 60-70% in secondary glioblastomas (progressed from lower-grade), with the difference being highly significant (p < 0.001). 4. **Mutation distribution**: Among detected mutations, IDH1 codon 132 variants will constitute 92-95% of all IDH mutations, with R132H as the predominant variant (65-70% of IDH1 mutations), and IDH2 codon 172 variants constituting 5-8% of total IDH mutations. 5. **Grade-dependent frequency**: IDH mutations will show decreasing frequency with increasing WHO grade: astrocytoma grade II (~90%), grade III (~85%), and grade IV (~75%), with a statistically significant trend (χ² trend p < 0.001). 6. **Age association**: IDH-mutant tumors will have significantly younger median age at diagnosis (median 38-42 years) compared to IDH wild-type tumors (median 58-65 years), with a mean difference of 18-23 years (p < 0.001, Cohen's d = 1.2-1.5). 7. **Concordance**: Sanger and NGS platforms will show 100% concordance for variants with allele frequency >10%. For sub-clonal variants (5-10% VAF), NGS sensitivity will exceed Sanger by a factor of 3-5×, with expected detection of 2-4 additional variants in the NGS cohort. ---

SUCCESS CRITERIA

- **Specimen quality**: ≥90% of extracted DNA samples meet QC thresholds (260/280 ≥1.8, DIN ≥3.0). Failure to achieve this threshold triggers repeat extraction or sample exclusion. - **PCR amplification**: ≥95% of samples yield specific amplification product (single band on gel) for both IDH1 and IDH2 targets. Samples with non-specific amplification or failure after 3 attempts are excluded from sequencing. - **Sequencing quality**: Sanger traces achieve Phred quality score ≥30 for >95% of bases in the target region. NGS runs achieve Q30 ≥85% with minimum 500× coverage at the hotspot codons. - **Mutation detection**: All positive control samples (BT142 DNA, IDH1 R132H plasmid) are correctly identified as mutant with 100% sensitivity. No mutations detected in NTC or wild-type U87 MG DNA (100% specificity). - **Statistical significance**: The difference in IDH mutation frequency between low-grade gliomas (II-III) and primary glioblastomas achieves p < 0.001 (Fisher's exact test), exceeding the Bonferroni-corrected threshold of p < 0.0083. - **Effect size**: The age difference between IDH-mutant and IDH wild-type groups exceeds Cohen's d = 1.0 (large effect), with the 95% confidence interval for the difference excluding zero. - **Data reproducibility**: Duplicate sequencing of 10% of samples (randomly selected) yields 100% concordance for variant calls. Discrepant results trigger repeat sequencing and independent blinded review.

PROTOCOL

**IDH1 and IDH2 Mutation Sequencing in CNS and Non-CNS Tumors** --- ### PHASE 1: Sample Acquisition and Pathological Validation (Day 1-7) **1.1 Sample Collection** - Collect formalin-fixed paraffin-embedded (FFPE) tumor samples from archived tissue banks - Minimum: 50 mg tissue per sample; macro-dissection for >70% tumor cellularity - Include CNS tumors (astrocytomas WHO grade II-IV, oligodendrogliomas, glioblastomas) and non-CNS tumors (colorectal carcinoma, acute myeloid leukemia, cholangiocarcinoma) as comparator cohort - Collect corresponding adjacent normal tissue (when available) as germline control **1.2 Histopathological Review** - H&E staining of 5 μm sections for neuropathologist confirmation - Tumor cellularity quantification via ImageJ densitometry (threshold: ≥40% tumor nuclei) - WHO classification and grade assignment per current Classification of CNS Tumors **Reagents/Equipment:** - Ethanol (100%, 95%), xylene, hematoxylin, eosin Y - Microtome (Leica RM2235), coverslips, slides --- ### PHASE 2: Nucleic Acid Extraction and Quality Control (Day 8-10) **2.1 Genomic DNA Extraction** - Use QIAamp DNA FFPE Tissue Kit (Qiagen, 56404) - Deparaffinization: 1 mL xylene, 55°C, 3 min; repeat twice - Proteinase K digestion: 20 μL proteinase K (20 mg/mL), 56°C, 1 h, then 90°C, 1 h - DNA binding: column binding, 600 μL AW1 wash, 700 μL AW2 wash - Elution: 30 μL ATE buffer, 56°C, 5 min; repeat with 20 μL **2.2 RNA Extraction (optional for expression analysis)** - RNeasy FFPE Kit (Qiagen, 73504) **2.3 Quality Control** - Quantify DNA concentration: Qubit 4.0 Fluorometer (Thermo Fisher) with Qubit dsDNA HS Assay Kit - Measure260/280 and 260/230 ratios: NanoDrop 2000 - Acceptable ranges: 260/280 ≥1.8; 260/230 ≥1.5 - Fragment analysis: Agilent 4200 TapeStation with Genomic DNA ScreenTape - Minimum requirement: DIN (DNA Integrity Number) ≥3.0 or >300 bp median fragment length **Reagents/Equipment:** - QIAamp DNA FFPE Tissue Kit, Qubit 4.0, NanoDrop 2000, Agilent 4200 TapeStation --- ### PHASE 3: PCR Amplification of IDH1 and IDH2 Hotspot Regions (Day 11-12) **3.1 Target Region Selection** - **IDH1**: Exon 4, codon 132 (GRCh37 chr2:209113112-209113228) - **IDH2**: Exon 4, codon 172 (GRCh37 chr15:90088500-90088650) **3.2 Primer Design** Synthesize primers with M13 tails for Sanger sequencing: | Gene | Forward Primer (5'→3') | Reverse Primer (5'→3') | Amplicon Size | |------|------------------------|------------------------|---------------| | IDH1 R132 | TGTGGTTTGTAAAGTGTGCC | AAGCCCATCACCATTGTTACC | 187 bp | | IDH2 R172 | TGGTGAGTGGATGGGTAAAC | ACTGACCACTGTTACCCTGC | 189 bp | **3.3 PCR Reaction Setup** - Template: 50-200 ng genomic DNA - KAPA HiFi HotStart PCR Kit (KAPA Biosystems, KK2502) - Final reaction volume: 25 μL - Cycling conditions: - 95°C, 3 min (initial denaturation) - 98°C, 20 sec × 35 cycles - 60°C (IDH1) or 58°C (IDH2), 15 sec - 72°C, 30 sec - 72°C, 2 min (final extension) **3.4 PCR Optimization** - Gradient PCR if non-specific amplification observed (annealing temperature gradient: 58-68°C) - Include positive control: DNA from BT142 cells (IDH1 R132H mutant) or U87 MG cells transfected with mutant plasmid - Include no-template control (NTC): sterile water **Reagents/Equipment:** - KAPA HiFi HotStart PCR Kit, thermal cycler (Bio-Rad CFX96), gel electrophoresis system, 100 bp DNA ladder --- ### PHASE 4: Sequencing Library Preparation and Sequencing (Day 13-16) **4.1 Agarose Gel Electrophoresis Validation** - 2% agarose gel, 100 V, 40 min - Visualize with GelRed stain under UV transilluminator - Expected: single band at expected amplicon size **4.2 Sanger Sequencing (Gold Standard Validation)** - Purify PCR products: ExoSAP-IT Express (Thermo Fisher, 75001) - Cycle sequencing: BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher, 4337456) - Sequencing reaction: 96°C, 1 min × 25 cycles (96°C, 10 sec; 50°C, 5 sec; 60°C, 2 min) - Ethanol/EDTA precipitation: 3M sodium acetate, 125 mM EDTA, 100% ethanol - Capillary electrophoresis: Applied Biosystems 3730xl DNA Analyzer **4.3 Next-Generation Sequencing (NGS) Panel (Optional)** - For comprehensive panel: Illumina TruSight Tumor 15 or custom IDH1/IDH2 assay - Library preparation: KAPA HyperPlus Kit - Sequencing: Illumina MiniSeq, 2×150 bp paired-end reads - Minimum depth: 500× coverage for variant calling **Controls:** - Sequencing vector control: pCMV6-IDH1 R132H plasmid (Origene, TP300950) - Internal calibration: spike 5% mutant allele into wild-type DNA --- ### PHASE 5: Bioinformatics Analysis and Variant Calling (Day 17-19) **5.1 Sanger Sequencing Analysis** - Base calling: Sequencing Analysis Software v5.4 (Applied Biosystems) - Sequence alignment: Geneious Prime or Benchling - Variant calling: Compare to reference sequences (IDH1: NM_001609.4; IDH2: NM_002168.4) **5.2 NGS Data Analysis Pipeline** - Quality control: FastQC v0.11.9 - Alignment: BWA-MEM2 to GRCh38 - Variant calling: GATK HaplotypeCaller (minimum quality score ≥30) - Filter variants: QD <2.0, FS >60.0, MQ <40.0 - Annotation: ANNOVAR, dbSNP Build 153, COSMIC v99 **5.3 Variant Classification** - Pathogenic mutations: R132H, R132C, R132G, R132L, R132S (IDH1); R172K, R172M, R172G (IDH2) - Interpret using ACMG/AMP guidelines for variant classification - Protein structure validation: I-TASSER or AlphaFold2 --- ### PHASE 6: Statistical Analysis and Interpretation (Day 20-21) **6.1 Descriptive Statistics** - Mutation frequency: percentage with 95% confidence intervals (Wilson score interval) - Stratify by: tumor type, WHO grade, patient age, sex, anatomical location **6.2 Comparative Analysis** - Fisher's exact test for categorical variables - Chi-square test for trend across grades - Mann-Whitney U test for continuous variables (age) - Bonferroni correction for multiple comparisons (adjusted α = 0.05/6 = 0.0083) **6.3 Power Analysis** - Sample size calculation: G*Power 3.1 - Effect size estimation based on literature (IDH mutation frequency ~80% in astrocytomas, ~90% in oligodendrogliomas, ~10% in primary glioblastomas) - Target power: 0.80; α = 0.05 ---

LINKED HYPOTHESES

HTML iframe

<iframe src="http://scidex.ai/artifact/exp-5d41798b-6449-48f5-b8cd-02400ecc2d6c?embed=1" width="100%" height="600" style="border:0;border-radius:8px"></iframe>

Markdown link

[IDH1 and IDH2 mutation sequencing in CNS and non-CNS tumors](http://scidex.ai/artifact/exp-5d41798b-6449-48f5-b8cd-02400ecc2d6c)

Direct URL

http://scidex.ai/artifact/exp-5d41798b-6449-48f5-b8cd-02400ecc2d6c

Preview