ABT263 treatment in sublethally irradiated mice

PRIMARY OUTCOME

depletion of senescent cells and mitigation of TBI-induced premature aging

EXPECTED OUTCOMES

1. **Survival**: 100% survival in sham groups; ≥85% survival in TBI groups (ABT263 may slightly reduce survival due to on-target senolytic activity in platelets) 2. **SA-βgal+ Cell Burden (Week 16)**: - TBI-vehicle: 18.4 ± 4.2% SA-βgal+ cells in liver - TBI-ABT263: 8.1 ± 2.1% SA-βgal+ cells (55% reduction, p < 0.001) 3. **p16INK4a mRNA Expression (Week 16, liver)**: - TBI-vehicle: 4.7 ± 0.9 fold increase vs sham-vehicle - TBI-ABT263: 2.1 ± 0.6 fold increase vs sham-vehicle (p < 0.01) 4. **Rotarod Performance (Week 16)**: - Sham-vehicle: 245 ± 28 seconds - TBI-vehicle: 167 ± 31 seconds (31% impairment, p < 0.001) - TBI-ABT263: 218 ± 24 seconds (73% improvement vs TBI-vehicle, p < 0.01) 5. **Serum IL-6 (Week 16)**: - Sham-vehicle: 12.4 ± 3.1 pg/mL - TBI-vehicle: 47.8 ± 9.2 pg/mL (3.9-fold elevation, p < 0.001) - TBI-ABT263: 24.6 ± 6.8 pg/mL (48% reduction vs TBI-vehicle, p < 0.01) 6. **Grip Strength (Week 16)**: - TBI-vehicle: 62% of sham-vehicle baseline - TBI-ABT263: 81% of sham-vehicle baseline (p < 0.05) 7. **Telomere Length (Week 16, liver)**: - TBI-vehicle: T/S ratio 0.68 ± 0.07 (vs 1.0 for sham) - TBI-ABT263: T/S ratio 0.81 ± 0.06 (p < 0.05) ---

SUCCESS CRITERIA

- **SA-βgal reduction**: ABT263 treatment reduces SA-βgal+ cell burden by ≥40% in liver, kidney, and lung combined compared to TBI-vehicle (two-tailed Mann-Whitney U test, p < 0.05) - **Functional improvement**: Statistically significant improvement in rotarod latency in TBI-ABT263 vs TBI-vehicle groups (two-way ANOVA with Bonferroni post-hoc, p < 0.01) - **Inflammaging suppression**: Serum IL-6 levels in TBI-ABT263 group ≤50% of TBI-vehicle levels (Welch's t-test, p < 0.01, effect size Cohen's d ≥ 0.8) - **p16INK4a knockdown**: ≥40% reduction in p16INK4a mRNA in liver tissue of TBI-ABT263 vs TBI-vehicle (ΔΔCt analysis, p < 0.01) - **No toxicity threshold**: No more than 15% body weight loss in any ABT263-treated group compared to vehicle controls at any timepoint (one-way ANOVA, p > 0.05) - **Histopathological improvement**: Semiquantitative pathology scores for liver and kidney show ≥1-point improvement on 0–4 scale in TBI-ABT263 vs TBI-vehicle (Kruskal-Wallis, p < 0.05) - **Telomere preservation**: T/S ratio in TBI-ABT263 significantly higher than TBI-vehicle (Welch's t-test, p < 0.05, effect size Cohen's d ≥ 0.6)

PROTOCOL

### Study Design Overview - **Model**: C57BL/6J female mice (12-week-old) - **Groups**: 4 groups (n=15/group) 1. Sham irradiation + Vehicle 2. Sham irradiation + ABT263 3. Sublethal TBI (7 Gy, single dose) + Vehicle 4. Sublethal TBI + ABT263 - **ABT263 Dose**: 50 mg/kg/day, oral gavage, 5 days on/2 days off for 8 weeks - **Total Duration**: 16 weeks post-irradiation --- ### PHASE 1: Baseline & Irradiation (Day 0) **Timepoints**: Day 0 **Methods**: 1. Randomize 60 mice into 4 groups using stratified randomization by body weight 2. For TBI groups: Whole-body irradiation using Cs-137 γ-ray source (Shepard C-120, 0.98 Gy/min, dose rate calibrated with ion chamber) 3. Total dose: 7 Gy (sublethal, ~80% survival) 4. Sham groups: Same handling without irradiation 5. Record baseline body weight, food consumption, and motor function (rotarod test) **Reagents/Equipment**: - ABT263 (Selleckchem, S1001) - dissolved in 10% DMSO + 30% PEG400 + 60% saline - Vehicle: 10% DMSO + 30% PEG400 + 60% saline - Cs-137 irradiator (Shepard C-120) --- ### PHASE 2: Treatment Period (Week 1–8) **Timepoints**: Daily (5 days/week) **Methods**: 1. ABT263 or vehicle administered via oral gavage (10 μL/g body weight) 2. Monitor daily for: - Body weight (twice weekly) - Food/water consumption (weekly) - General health score (ruffled fur, mobility, posture) 3. Rotate injection sites to prevent tissue irritation **Reagents/Equipment**: - Oral gavage needles (22 gauge, 1.5 inch) - Precision balance (Mettler Toledo) --- ### PHASE 3: Phenotypic Assessment - Physical Function (Week 4, 8, 12, 16) **Timepoints**: Week 4, 8, 12, 16 **Methods**: **Rotarod Test**: - Apparatus: Rotarod (IITC Life Science) - Protocol: Accelerating rotation 4–40 rpm over 300 seconds - Record latency to fall (maximum 300 sec) - 3 trials per session, 15 min rest between trials **Grip Strength Test**: - Meter: Chatillon DFE II digital force gauge - Measure forelimb grip force (grams force) - 5 consecutive measurements per session **Treadmill Endurance Test**: - Equipment: Columbus Instruments Exer3/6 - Protocol: 10 m/min for 2 min, then 2 m/min increments every 2 min up to 26 m/min - Record exhaustion time and distance --- ### PHASE 4: Senescence Biomarker Assessment (Week 8 and Week 16) **Timepoints**: Week 8 (n=5/group terminal), Week 16 (n=10/group terminal) **Methods**: **Tissue Collection**: 1. Euthanize by CO₂ inhalation (approved protocol) 2. Collect: liver, kidney, lung, quadriceps muscle, brain (cortex), heart, and bone marrow 3. Tissues flash-frozen in liquid N₂ or fixed in 4% paraformaldehyde **SA-βgal Staining (Cryosections)**: - 10 μm cryosections - Stain with X-gal solution: 1 mg/mL X-gal, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl₂ in PBS (pH 6.0) - Incubate 16 hours at 37°C (no CO₂) - Counterstain with eosin - Count SA-βgal+ cells per 1000 cells in 10 random fields (200x magnification) **Quantitative PCR (qPCR) for Senescence Markers**: - RNA extraction: RNeasy Mini Kit (Qiagen, 74104) - Reverse transcription: SuperScript III (ThermoFisher) - qPCR primers (Applied Biosystems): - p16INK4a: Mm00494448_m1 - p21CIP1: Mm04240740_g1 - IL-6: Mm00446190_m1 - MMP-3: Mm00440295_m1 - GAPDH (endogenous control) - Normalize using ΔΔCt method **Western Blot**: - 30 μg protein per lane - Primary antibodies: anti-p16 (Abcam ab189034, 1:500), anti-p21 (Abcam ab188224, 1:500), anti-Bcl-xL (Cell Signaling #2764, 1:1000), anti-β-actin (Sigma A2228, 1:5000) - Secondary: HRP-conjugated anti-rabbit (Cell Signaling #7074, 1:5000) - Detection: ECL substrate (ThermoFisher) --- ### PHASE 5: Inflammaging & Cytokine Profiling (Week 8, Week 16) **Timepoints**: Week 8, Week 16 **Methods**: - Serum collected via cardiac puncture - Multiplex cytokine assay (MILLIPLEX MAP Mouse Cytokine/Chemokine Panel, MCYTOMAG-70K): - IL-1β, IL-6, TNF-α, IFN-γ, CXCL1, CCL2 - Analysis using Luminex MAGPIX system --- ### PHASE 6: Comprehensive Tissue Analysis (Week 16, Terminal) **Timepoints**: Week 16 (final endpoint) **Methods**: **Histopathology**: - H&E staining of liver, kidney, lung, quadriceps - Scoring for: - Hepatocyte nuclear atypia (0–4 scale) - Renal tubular degeneration (0–4 scale) - Alveolar septal thickening (0–4 scale) - Muscle fiber cross-sectional area (μm²) **Telomere Length Analysis (qPCR)**: - Extract genomic DNA from liver and blood - Telomere primer sequences: - Telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT - Telc: GGTTGCGGGGGCTGGGTT - Reference single-copy gene: 36B4 - Telomere/Single-Copy Gene ratio (T/S ratio) **DNA Damage Markers (γH2AX foci)**: - Immunofluorescence on tissue sections - Primary: anti-γH2AX (phospho-S139, Abcam ab2893, 1:200) - Secondary: Alexa Fluor 488 anti-mouse (1:500) - Count foci per nucleus (n=100 nuclei per sample) **Bone Marrow Senescence Burden**: - Flow cytometry of bone marrow cells - Staining: anti-CD45-BV605, anti-CD11b-PE, anti-p16INK4a-FITC (flow cytometry) - Analyze on BD LSRFortessa ---

HTML iframe

<iframe src="http://scidex.ai/artifact/exp-c95e784a-0ed5-4619-89e8-9a11a158ff65?embed=1" width="100%" height="600" style="border:0;border-radius:8px"></iframe>

Markdown link

[ABT263 treatment in sublethally irradiated mice](http://scidex.ai/artifact/exp-c95e784a-0ed5-4619-89e8-9a11a158ff65)

Direct URL

http://scidex.ai/artifact/exp-c95e784a-0ed5-4619-89e8-9a11a158ff65

Preview